1

Creation: The Origin of Life / The Future of Life

Specifikacijos:
Autorius: Adam Rutherford, Nenurodyta
Puslapių skaičius: 272, Nenurodyta
Leidimo metai: 2014
Prekės ID: 59010253
2359
Pardavėjas: EasyShop 4.2
Į krepšelį
Jūsų miestas

Vilniuje, parduotuvėje (Laisvės pr. 75)

Balandžio 9 d.

000

Vilniuje, parduotuvėje (Upės g. 9 (PC „CUP“))

Balandžio 9 d.

000

Kaune, Klaipėdoje, Šiauliuose, Panevėžyje, parduotuvėje

Balandžio 9 d.

000

Lietuvos pašto skyriuje

Balandžio 9 d.

149

LP EXPRESS terminale

Balandžio 9 d.

219

Atsiimkite Omniva paštomate

Balandžio 9 d.

265

Atsiimkite SmartPosti terminale

Balandžio 9 d.

269

Pristatysime į namus

Balandžio 9 d.

349

Dėmesio! Pristatymo terminai yra preliminarūs, kadangi terminai atsinaujina priklausomai nuo faktinio užsakymo pateikimo ir apmokėjimo laiko. Galutinis pristatymo terminas yra pateikiamas Pigu.lt patvirtinus užsakymą.

Pardavėjas: EasyShop 4.2

Kiti taip pat domėjosi

Prekės aprašymas: Creation: The Origin of Life / The Future of Life

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution. 'A superbly written explanation' Brian Cox This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Bendra informacija apie: Creation: The Origin of Life / The Future of Life

Prekės ID: 59010253
Kategorija: Ekonomikos knygos
Prekės pakuočių kiekis: 1 vnt.
Pakuotės išmatavimai ir svoris (1): 0,02 x 0,13 x 0,2 m, 0,19 kg
Leidykla: Penguin Books Ltd
Leidinio kalba: Anglų
Viršelio tipas: Kietas
Formatas: Tradicinė knyga
Tipas: Nenurodyta
Knyga su ištrauka: Taip
Pardavėjo šalis: Lietuva
Pardavėjas: Knygynas Krisostomus, EasyShop
Autorius: Adam Rutherford, Nenurodyta
Puslapių skaičius: 272, Nenurodyta
Leidimo metai: 2014

Prekių nuotraukos skirtos tik iliustraciniams tikslams ir yra pavyzdinės. Prekės aprašyme esančios video nuorodos yra tik informacinio pobūdžio, todėl jose pateikiama informacija gali skirtis nuo pačios prekės. Originalių produktų spalvos, užrašai, parametrai, matmenys, dydžiai, funkcijos, ir/ar bet kurios kitos savybės dėl savo vizualinių ypatybių gali atrodyti kitaip negu realybėje, todėl prašome vadovautis prekių savybėmis, kurios nurodytos prekių aprašymuose.

Partnerių pasiūlymai
Reklama

Įvertinimai ir atsiliepimai (0)

Creation: The Origin of Life / The Future of Life
Būkite pirmas parašęs atsiliepimą!
Šią prekę gali įvertinti tik ją įsigiję bei registruoti Pigu.lt pirkėjai.
Įvertinti prekę

Klausimai ir atsakymai (0)

Paklauskite apie šią prekę kitų pirkėjų!
Užduoti klausimą
Jūsų klausimas buvo sėkmingai pateiktas. Į klausimą bus atsakyta per 3 darbo dienas
Klausimą turi sudaryti bent 10 simbolių

Rekomenduojame kartu su: Creation: The Origin of Life / The Future of Life

Reklama

Geriausi pardavėjo EasyShop pasiūlymai